Jeudi, 21 septembre 2017
Accueil et conférences d'ouverture

#La Bombe – Toute la vérité sur Cambridge Analytica


Hannes Grassegger, journaliste et économiste, Zurich

Comment un reportage de la publication suisse « Das Magazin », sur un texte de l’année 2016 essentiellement diffusé en langue allemande, a été lu par des millions de lecteurs en un temps record, puis a fait l’objet d’une publication virale dans 20 autres langues – et a déclenché une tout autre discussion dans chaque pays. L’histoire de la réception de ce texte en langue allemande peut-être le plus controversé de ces dernières années est un enseignement sur les difficultés et les possibilités du journalisme à une époque de progrès technologique fulgurant. L’auteur clé du magazine, Hannes Grassegger, analyse pour la première fois les répercussions du texte écrit avec Mikael Krogerus.

Workshops

Virtual & Augmented Reality dans la formation : opportunités et possibilités

 

Raphael Wild und Max Hemmo, Lernetz, Berne

 

Site

 

 

Les possibilités techniques de l’Augmented Reality (AR) et de la Virtual Reality (VR) sont immenses. Ce workshop entend présenter les méthodes et offres de formation qui peuvent être utilisées dans ce domaine.
1/ l’exploration peut se faire avec les appareils suivants avec les contenus que nous produisons : Highend AR (Microsoft Hololens), Lowend AR sur smartphone, lunettes VR Highend (HTC Vive) ainsi que Lowend VR (Google Cardboard). Cette gamme de produits permet une large évaluation des avantages et des inconvénients de ces nouvelles technologies utilisées.
2/ grâce aux inputs de la partie Hand’s on, des esquisses de projet et des scénarios d’utilisation VR et AR adéquats sont développés et présentés.
3/ input sur la faisabilité et le workflow de projets AR/VR : présentation des méthodes pour passer de l’idée à une application 3D finale.

L’atelier du mot


Beatrice Lugger et Tobias Maier, Institut national de la communication scientifique, Karlsruhe

 

Site

 
On peut tout à fait dire que la langue est un artisanat. Qu’entend-on précisément par là ? Grâce à notre boîte à outils, nous chercherons ce qui pourrait nous permettre de retoucher une phrase que nous aurons construite nous-mêmes, le tout dans une compétition ludique. Quelques astuces simples suffisent pour qu’un texte soit non seulement correct du point de vue du contenu, mais aussi immédiatement compris. Il est aussi indispensable d’utiliser un langage parlant et précis pour transmettre des contenus aux interdépendances complexes. « La science pour tous », cela signifie aussi formuler la communication dans le domaine scientifique de telle sorte que tout le monde puisse comprendre de quoi il retourne. Les participantes et participants apprendront de manière vivante à l’« atelier du mot » quels outils linguistiques sont à leur disposition pour les aider. A cet effet, nous formerons des équipes qui s’affronteront pour trouver la solution la plus convaincante en montrant leur esprit sportif et linguistique. Voyons qui sera le meilleur à remanier les formulations alambiquées, les exemples incohérents et les mots superflus. L’« atelier du mot » est dirigé par des professeurs expérimentés de l’Institut national de la communication scientifique (NaWik).
Dialog Session 1

Next Trends from San Francisco


Rahel Meier, Sustainability Communications Group, ZHAW und NCCR Digital Fabrication und Tanja Coray, NCCR Digital Fabrication, Zurich

 

Site

 

Site

 

 

 

 

The San Francisco Bay Area is well-known for exploring innovation in storytelling and outreach – things like virtual and augmented reality, crowdfunding, events and festivals, the maker movement, and social media storytelling. How do these trends apply to the field of science communication in San Francisco and what lessons can Switzerland learn from this ecosystem? In June and July, Rahel Meier and Tanja Coray will explore the science communication landscape of San Francisco as the first two fellows of swissnex San Francisco’s new Pier 17 Science Studio program. During this session, Rahel and Tanja will report what they discovered through meetings with various museum experts, artists, and science communication professionals, and what they learned by carrying out their fellowship project. The discussion focuses on how these findings can be transferred to the Swiss science communication community.

Leonardo multimedial : la communication scientifique basée sur des pairs par les adolescents


Prof. Matthias Künzler et Prof. Thomas Weibel, Haute Ecole de technique et d’économie, Coire

 

Site

La communication scientifique est confrontée à la difficile tâche d’atteindre les adolescents n’ayant pas d’affinité avec les sciences qui doivent choisir une orientation. C’est une problématique importante actuellement compte tenu de la pénurie de main d’oeuvre spécialisée et des exigences croissantes imposées par la numérisation du monde professionnel. Une équipe interdisciplinaire composée de producteurs multimédia et de spécialistes des sciences sociales a imaginé une nouvelle approche : mettre la spontanéité des adolescents dans l’utilisation de nouvelles technologies au service de la communication scientifique. L’objectif est de permettre aux adolescents de produire avec leurs propres appareils (portables, tablettes, ordinateurs), selon le principe BYOD (« bring your own device »), des reportages scientifiques multimédia et de les diffuser dans leurs groupes de pairs en étant coachés par des spécialistes. Le projet financé par la Fondation Gebert Rüf sera présenté plus en détail aux participants du congrès d’une manière pratique : après une brève introduction, ils auront l’occasion de tester eux-mêmes les possibilités techniques qu’offrent les appareils mobiles d’aujourd’hui. Un écran vidéo, un iPad, des flyers de formation et les appareils des participants seront utilisés comme moyens auxiliaires.

L’ADN autrement


Dr. Marie-Claude Blatter, SIB Institut Suisse de Bioinformatique, Genève

 

Site

Le SIB Institut Suisse de Bioinformatique a mis sur pied un atelier modulable tout public dont l’objectif est : (1) de présenter de manière ludique et authentique comment est vu l’ADN à l’ère du numérique, (2) d’utiliser des outils bioinformatiques pour mieux comprendre la notion de « mon » génome, (3) d’introduire le lien entre données moléculaires et l’évolution et (4) d’ouvrir la discussion sur des thèmes de société, comme la médecine personnalisée. L’atelier comprend des activités basées sur le livre dans lequel a été imprimée la séquence ADN du chromosome 21 humain (48 millions de nucléotides, 1470 pages) et l’utilisation d’un Genome Browser (libre d’accès sur internet)pour (re)découvrir l’ADN à l’aide de manipulations simples. Retrouvez-vous une séquence ADN du chromosome 21 humain chez le chimpanzé ? Cette séquence ADN «atgcaatcatatgcttctgct» appartient-elle à un homme ou à une femme ? Pensez-vous retrouver une séquence ADN écrite au hasard dans le génome humain ?

Show Me Maths!


Dr. Shaula Fiorelli Vilmart, coresponsable Mathscope, Université de Genève

 

Site

Les mathématiques, science où l’on ne peut rien manipuler, car ses objets sont abstraits ? Pas au Mathscope ! Au laboratoire du Scienscope de l’Université de Genève dédié aux Mathématiques, on touche, manipule, expérimente, parfois avec tout son corps, de nombreux concepts allant de la géométrie à la logique en passant par la topologie, les probabilités et les statistiques. Ouvert aux groupes de 5 à 25 personnes de 4 à 104 ans, le Mathscope offre des ateliers interactifs d’une heure où le maître-mot est expérimenter. Mais pas seulement ! L’équipe du Mathscope participe depuis deux ans au concours de shows scientifiques Science Me ! et a même remporté le prix du jury lors de la première édition en 2016. Mais comment construire un show de 10 minutes sur une notion aussi abstraite que celle de la dimension ? Comment rendre manipulable des concepts mathématiques ? Peut-on concevoir un atelier interactif sur n’importe quel sujet mathématique tout en éveillant la curiosité ? C’est au travers de quelques exemples et de situations pratiques que nous tenterons de répondre à ces questions.

Un prix pour mieux faire connaître les sciences citoyennes en Autriche


Petra Siegele, service autrichien des échanges, Ministère fédéral de la science, de la recherche et de l’économie, Vienne

 

Site

Afin de diffuser les connaissances sur les sciences citoyennes en Autriche, le Ministère des sciences, de la recherche et de l’économie soutient depuis 2015, avec le prix Citizen Science, des projets de (1) les sciences citoyennes sélectionnés pour inciter des (2)les citoyens scientifiques engagés à collaborer à des projets de recherche. Le soutien prend la forme de prix dotés de 3000 euros, mais aussi de mesures dans le domaine des relations publiques dans toute l’Autriche ou encore d’ateliers de réflexion réguliers pour les projets de recherche participants. Les récompenses sont décernées dans le cadre d’une manifestation festive médiatisée à Vienne. Le Ministère a confié la mise en oeuvre de cette initiative au Zentrum für Citizen Science rattaché au service autrichien d’échange universitaire (OeAD GmbH). Lors de son intervention, Petra Siegele, directrice du centre, abordera en détail les mesures de marketing et de communication visant à promouvoir le prix ainsi que les leçons tirées jusqu’ici aussi bien dans le marketing que dans la mise en oeuvre de l’initiative dans son ensemble. Quels groupes cibles avons-nous convaincu de participer ? Quels défis liés à l’instauration des prix les projets de recherche doivent-ils relever ? Dans quelle mesure le Centre peut-il apporter son aide ?
Workshop

Tinkering : des ateliers pour développer la créativité technique


Dr. Richard-Emmanuel Eastes, Groupe Traces, Paris

 

Site

 

Présentation

 

Tinkering

Bien au-delà de la transmission de connaissances, la médiation scientifique peut permettre de lutter contre l’autocensure des jeunes gens et des jeunes filles vis-à-vis de la science et de la technologie. Parmi les approches possibles, les ateliers de créativité technique développés par l’Exploratorium de San Francisco et repris par l’Espace des sciences Pierre-Gilles de Gennes à Paris constituent un outil particulièrement performant pour développer à la fois la curiosité et l’empowerment technique, entrepreneurial, social, de genre. Leur finalité n’est pas tant d’enseigner des notions scientifiques que de faire réaliser aux publics qu’en dépit d’une faible confiance en eux, ils disposent des ressources nécessaires pour répondre à des défis apparemment complexes. Durant cet atelier, nous présenterons le concept de tinkering en l’illustrant par quelques exemples avant de le mettre en pratique expérimentalement. Comment construire une machine qui vole ? Une machine qui dessine ? Une machine qui réalise « quelque chose » mais s’autodétruit après 5 min. de fonctionnement ? La fin de l’atelier sera consacrée à la discussion des enjeux, avantages et limites de cette approche originale.
Speed Talk Session 1

The Crowdfunding Freak Show


Luc Henry, Science Booster at wemakeit.com, Zurich

 

Site

 

Présentation

The popularity of Crowdfunding is on the rise – also in science. With our «Crowdfunding Freak Show», we discuss a selection of projects that successfully collected funding through our Science Booster, the first crowdfunding channel in Switzerland entirely dedicated to science (science.wemakeit.com).

Show Me Science ! L’égalité comme instantané filmé :
les expériences d’un projet AGORA


Lucie Bader, outreach gmbh – film et communication scientifique, Berne

 

Site

 

Présentation

Etes-vous à la page sur l’égalité hommes-femmes ? L’égalité salariale ? Le temps partiel ? Visionnez le film « L’égalité – un instantané », nourrissez-vous des connaissances de base avec l’E-Learning Box ou servez-vous des instructions du workshop pour votre formation continue en entreprise ! Le projet AGORA « gleichstellen.ch » offre tous ces moyens de communication. Ils ont été développés dans le cadre du projet pour le dialogue interactif avec le public et sur la base de connaissances en matière de sciences sociales. Le projet a pour but de montrer les mécanismes à l’origine de la reproduction des inégalités spécifiques au genre et de proposer des mesures pour renforcer l’égalité. Le film documentaire, du matériel pour les ateliers et une E-Learning Box sont mis gratuitement à votre disposition sur le site Internet «www.gleichstellen.ch». Ils ont été conçus à la Haute Ecole de Lucerne avec le soutien d’AGORA. Nous présenterons les défis que l’équipe de projet a dû relever, de l’idée jusqu’à la première présentation et les expériences qu’elle a ainsi acquises dans le domaine de la communication scientifique.

La génétique dans les médias imprimés suisses


Bettina Zimmermann, Institut d’éthique médicale et de bioéthique, Université de Bâle

 

Site

 

Présentation

Diagnostic préimplantatoire, technique CRISPR ou tests génétiques grâce à Internet : il existe tout un champ de tension dans les thèmes liés à l’information au public. Dans quelle mesure bénéficient-ils d’un éclairage médiatique ? Dans le cadre de mon doctorat à l’Université de Bâle, j’ai analysé quels thèmes liés à la génétique humaine ont été abordés dans les médias imprimés en Suisse alémanique et romande au cours des quatre dernières années et à quelle fréquence. Les résultats reflètent jusqu’à un certain point le discours scientifique public en Suisse, qui a notamment fait la part belle aux votations sur le diagnostic préimplantatoire. Le Speed Talk sera pour moi l’occasion de présenter quelques résultats de mes études ainsi que de mettre en lumière et de discuter des implications possibles sur le journalisme scientifique.

Une Newsroom pour la communication des hautes écoles : bonne ou mauvaise idée ?


Jürg Dinner, directeur de la communication, Université de Zurich

 

Site

 

Présentation

 

La numérisation dans la communication ne s’arrête pas aux portes des hautes écoles. Nouveaux médias, travaux cross-médias ou digital first ne sont que quelques mots clés. La Newsroom citée ici à maintes reprises est-elle une approche envisageable ? Qu’estce qu’une Newsroom ? Les thèmes et les canaux peuvent-ils vraiment être séparés ? La plus grande haute école de Suisse a réinventé sa communication. Comment ? Et quelles ont été ses expériences en la matière ? Quels sont les enseignements pour ma haute école ou ma rédaction ?

L’expérimentation au service des stratégies d’apprentissage


Dr. Mona Spiridon, Bioscope et Geneva Neurocenter, Université de Genève

 

Site

 

Présentation

Pour persuader les gens du bien-fondé d’une méthode, la présentation de faits scientifiques n’est parfois pas suffisante. L’activité « Mémoire et apprentissage » développée par le Bioscope, laboratoire public de l’Université de Genève, en collaboration avec le Geneva University Neurocenter, aborde les stratégies d’apprentissage. Pour se convaincre de l’efficacité de ces stratégies, les élèves les expérimentent et mesurent leurs propres résultats. Des études scientifiques sur ce sujet sont reproduites avec les élèves. Pour chaque type d’apprentissage, la classe est séparée en deux groupes ; chaque groupe utilise une stratégie différente. Grâce une interface sur tablette, les résultats des tests sont immédiatement accessibles aux élèves. Les élèves peuvent ainsi constater quel groupe a obtenu les meilleurs résultats et par conséquent quelle stratégie a le mieux fonctionné. Les résultats cumulatifs de toutes les classes ayant participé à l’activité sont aussi montrés. Cette approche va donc au-delà de la simple explication de faits scientifiques. Elle permet d’appuyer les recommandations sur la gestion du travail par des évidences scientifiques que les élèves auront eux-mêmes obtenu à travers l’expérimentation.
Vendrei, 22 septembre 2017
Accueil et conférences

Communicating scientific facts and the scientific process. Challenges and rewards.


Ana Godinho, Head of Education Communication and Outreach, CERN, Genf

 

Site

 

Présentation

It s a safe bet that everyone who works at CERN will, at some point, have been asked one, or both, of these questions: Will the LHC create a black hole that will destroy the Earth? What will CERN’s next big discovery be? These questions illustrate two of the major challenges that communicating the research carried out at CERN entails. One is how to communicate scientific knowledge when faced with myths and pseudo-scientific constructions, many of which have strong news value (for the media) and emotional appeal (for the public). The other is maintaining interest in CERN’s activities and in fundamental research in the face of a potential scarcity of «big breakthroughs» at the scale of the discovery of the Higgs boson in 2012.
This talk will describe how we tackle these big questions at CERN. Using examples, I will describe how CERN has proactively and successfully addressed the many myths around the LHC, antimatter and more. I will also describe how we are trying to fully explore our communication channels to find and tell stories about the diversity of scientific experiments at CERN, about CERN’s impact on society and about how scientific breakthroughs are often the cumulative results of small advances. This will be a talk about challenges and obstacles, but also opportunities and rewards, for CERN, for particle physics and for science communication.
Workshops

Raconter la science par le visuel !


Chris Spatschek et Daniela Leitner, Institut national de la communication scientifique, Karlsruhe

 

Site

Comprendre notre monde devient de plus en complexe. Et cela, les non-spécialistes et les néophytes ont souvent du mal à le comprendre et à l’imaginer. Les heures de gloire du texte pur font partie du passé et notre manière de communiquer les uns avec les autres est de plus en plus marquée par les images et les visualisations. La première perception de l’homme est toujours visuelle. Les images restent bien plus facilement ancrées dans la mémoire que du texte pur. Elles facilitent l’accès aux informations et les rendent plus compréhensibles. C’est précisément de cela dont nous voulons tirer parti. Nous plongerons dans le monde de la créativité en l’associant au monde de la science. Notre curiosité sera l’instrument le plus important pour observer les choses sous d’autres angles et remettre en question l’existant. Il s’agira enfin de mettre des idées sur papier, de transmettre les contenus d’une manière non conventionnelle, d’éveiller l’intérêt et d’atteindre à coup sûr le groupe cible. A noter que pour être créatif, il ne faut pas savoir dessiner ou utiliser des programmes de visualisation compliqués ! Le Workshop s’adresse à toutes les personnes qui sont ouvertes à la nouveauté et ont soif de connaissances.

Une communication scientifique efficace


Urs Müller, Institut de l’environnement et des ressources naturelles, ZHAW, Wädenswil et Sandra Wilhelm, anders kompetent GmbH, Winterthour

 

Site

 

Site

 

Présentation

Les acteurs de la communication scientifique sont souvent interrogés sur les résultats de leur travail. Ainsi, les donateurs, en majorité des fondations ou les pouvoirs publics, demandent de plus en plus souvent des preuves de l’impact de leurs investissements. Mais qu’entend-on par impact ? Comment peut-on l’augmenter ? Et comment peut-on être sûr d’atteindre l’impact visé ? Ces questions seront directement traitées lors du Workshop à l’aide des exemples de travail des participants. A cet effet, un instrument développé par le domaine de recherche Communication durable de l’Université des Sciences Appliquées de Zurich et anders kompetent GmbH – avec le soutien de la fondation Mercator Suisse, de l’Office fédéral de l’environnement et du WWF – sera présenté et utilisé. Celui-ci traite des trois étapes essentielles de l’orientation sur l’impact des offres de formation et de communication : formulation des objectifs et de la logique d’impact, optimisation des méthodes et des instruments et évaluation de la réalisation des objectifs. L’objectif du workshop est de permettre aux participants d’identifier les avantages d’une réflexion sur la logique d’impact et d’utiliser l’instrument présenté de manière autonome dans leur travail.

Excursion au Musée d’histoire naturelle de Soleure

Dans les coulisses d’une exposition


Dr. Thomas Briner, directeur du musée

 

Site

Les expositions font partie des moyens de médiation les plus importants des musées. Elles doivent donc atteindre un grand public – jeune et plus âgé, profane et expert. Une exposition doit informer, mais aussi divertir et faire appel autant que possible à tous les sens. Comment réussir une telle prouesse ? Quels sont les outils de médiation à disposition ? La réalisation de notre nouvelle exposition permanente permet de présenter des exemples concrets.

Pédagogie dans les musées : de classes d’école au travail d’intégration


Joya Müller, responsable pédagogique du musée

 

Site

Les visites de groupe au Muséum offrent la possibilité d’approfondir la matière. Environ 300 groupes le visitent chaque année et bénéficient des moyens mis à disposition. Des classes d’école, accompagnées ou non de la responsable pédagogique du Museum, ont la possibilité de travailler sur des tâches données et utilisent les outils pédagogiques du Muséum. Cette possibilité est également offerte pour favoriser l’intégration.
La responsable pédagogique du Muséum présente, à l’aide d’exemples pratiques, les différents outils de médiation.

Histoire de la Terre : éveiller l’intérêt pour les pierres

 

Silvan Thüring, responsable de collection sciences de la Terre / multimédia

 

Site

La géologie n’est pas facile à expliquer. Les pierres n’ont ni un regard adorable, ni un pelage soyeux. Et ce n’est pas le seul caillou dans la chaussure des non-initiés. L’histoire se déroule sur des millions d’années, elle est fascinante mais également déroutante. Grâce à ses expositions, le Muséum d’histoire naturelle de la ville de Soleure désire éveiller l’intérêt du public malgré la complexité de la thématique, et augmenter sa curiosité pour les sciences naturelles.
Speed Talk Session 2
«Science Me!» science show competition : the right format ?


Dr. Didier Perret, Chimiscope, University of Geneva

 

Site

 

Présentation

«Science Me!» is an innovative science communication tool, with the format of a competition organised during a science fair and bridging scientists and laymen: during 10 minutes, teams of 2 scientists make a show which is evaluated by the public (audience-weighted applause-meter signal) and by a jury of experts in science communication (quantitative multi-criteria ranking). The best teams are the winners, but what does «best team» mean? For the first occurrence of «Science Me!» (Geneva, 2016), a detailed analysis of the scores attributed by the audience and the jury indicates that the public is a smart evaluator reacting almost exclusively on the emotional aspects of a scientific demonstration (is it understandable, fun and spectacular?), while the experts focus on the rational aspects of the show (Is it based on sound background? Does it comply with safety rules?). This discrepancy calls into question the relevance of science communication initiatives meant at bringing scientific facts to the laymen in an affordable way.

It’s the genetics, stupid ! Comment traiter les informations génétiques d’aujourd’hui et de demain


Bettina Zimmermann, reatch, Zurich

 

Site

 

Présentation

La recherche dans le domaine de la génétique a fait des progrès considérables grâce aux nouvelles technologies. A l’avenir, les tests génétiques deviendront de plus en plus courants : dans votre pharmacie, chez votre gynécologue durant une grossesse, lors d’un bilan de santé classique, lorsqu’un membre de votre famille est testé positif, etc. Cette thématique ainsi que les choix à faire étant très complexes, il est primordial d’aborder ces questions fondamentales dès à présent : est-ce que je désire me soumettre à un test génétique spécifique ou non ? Est-ce que je désire être informé de tous les résultats ou non ? Est-ce que je parlerai des résultats des tests génétiques à ma famille ? Est-ce que je demanderai que des tests génétiques soient faits sur mon enfant né ou à naître ? Dans quelle mesure aimerais-je déterminer les caractéristiques biologiques par rapport à mon mode de vie ? reatch, un jeune think tank, prévoit de mettre en ligne une plateforme fondée sur une base factuelle qui informera de façon facilement compréhensible les profanes en la matière et favorisera la prise de décision pour ce genre de questions. reatch attache une importance majeure à la transparence des sources et aux discussions équilibrées. La plateforme sera interactive et donnera la possibilité de poster des commentaires sous toutes les rubriques. Elle possèdera également un chapitre questions-réponses.

Hépatite virale : une infection silencieuse qui mérite plus d’attention


Fabienne Schöpfer, Life Science Communication, Zurich

 

Site

 

Présentation

100 000 personnes atteintes, la moitié sans le savoir : les chiffres noirs des infections à hépatite en Suisse sont alarmants. L’objectif de la stratégie hépatite suisse est d’augmenter le nombre d’hépatites diagnostiquées. Mais comment susciter l’attention d’un groupe cible aussi vaste sur une maladie dont les conséquences n’apparaissent que des années plus tard ? Comment encourager les personnes du groupe cible à faire un test qui risque de les confronter à un résultat désagréable ? « Hépatite : vous connaissez l’ABC ? » est le mot d’ordre de la première phase d’une campagne de trois ans qui a pour vocation de transmettre des connaissances de base sur la maladie. La phase suivante a mis l’accent sur les situations à risque d’infection par hépatite aujourd’hui et par le passé. Le groupe cible a pu évaluer son risque à l’aide d’un test. La troisième phase de la campagne s’est déroulée sur la route pour approcher directement le groupe cible dans son quotidien avec une semaine de tests gratuits. L’exposé montre comment une campagne de plusieurs années a permis de sensibiliser un vaste groupe cible à un thème complexe qui dormait dans un tiroir et comment des outils interactifs, des vidéos et des activités dans les médias sociaux peuvent donner une pertinence individuelle à une situation de risque abstraite.

Engaging in a useful dialogue with the public: The Climate Garden 2085 experiment


Dr. Manuela Dahinden, Zurich–Basel Plant Science Center, Zurich

 

Site

 

Présentation

Climate change has been communicated as a global concern affecting us all, but there is still a disconnection between scientific information and political and social action – the climate paradox. This has been a cause for concern among scientists for some time now. But if, as psychologists tell us, the human brain responds better to experience than to analysis, then climate change must be told as a local and personal story – just as the Climate Garden 2085 does.
Conférence

La communication scientifique sur YouTube – un rapport


Paul Hoyningen, Université Leibniz de Hanovre et Université de Zurich

 

Site

 

Site

 

Présentation

Dans mon exposé, je parle de ma chaîne YouTube « PHoyningen », que j’anime depuis plus de quatre ans. Environ 220 vidéos y sont actuellement téléchargées, qui font l’objet de quelque 200 000 consultations par an. On y trouve notamment plusieurs conférences qui ont été données sur l’ensemble d’un semestre, ainsi que des exposés, des entretiens, des émissions de télévision et autres contenus similaires. De nombreux thèmes viennent de la philosophie scientifique, qui englobe la représentation populaire des contenus scientifiques. Je présenterai tout d’abord quelques caractéristiques de ma chaîne et les considérations qui m’ont guidées. J’aborderai ensuite quelques principes didactiques que je tente de prendre en compte dans mon activité d’enseignement et de conférencier. Je décrirai enfin brièvement le feedback étonnant que je reçois sans cesse.
Workshops

Des vacances scientifiques pour les adolescents


Jenny Flück, Science et Cité, Berne et Juanita Schläpfer-Miller, Zurich-Basel Plant Science Center, Zurich 

 

Site

 

Site

Depuis maintenant 3 ans, le projet Camp Discovery est mis en oeuvre dans toute la Suisse alémanique. L’objectif est d’atteindre les enfants et les adolescents ayant un faible niveau d’instruction et de leur faire découvrir le monde des sciences par l’intermédiaire de camps de vacances. Lors de la prochaine édition de Science Comm, nous souhaitons rassembler les différents acteurs autour d’une table et débattre de la manière de transmettre de manière passionnante le goût de la science dans un camp de vacances. Après une brève introduction sur le projet de Science et Cité et sur Plant Science Center Zurich-Basel, nous formerons des groupes pour travailler sur différentes problématiques et les présenter ensuite en plénum. En outre, les différents organismes de camps de vacances et les concepteurs de programmes pour enfants seront mis en réseau.

What if we applied insights from neuroscience to the democratic discourse?


Jannes Jegminat, Institute for neuroinformatics (UZH/ETH), Zurich and Valeria Eckhardt, Institute of neuropathology (University hospital Zurich)

 

Site

 

Site

 

Présentation

Filter bubbles, shit-storms and ever more polarised opinions: Is the democratic discourse broken? We can no longer blame the individual citizen for a lack of media competence or education – because technology is changing the very nature of how public debate works. Instead, it might be time to consider and actively design the architecture and dynamics of opinion networks. As inspiration for potential solutions, we will turn to neuroscience. Just like opinion networks, the brain is a network of many individual information processing units, the neurons; and both networks share analogous problems.
After a short input on neuronal information processing, we travel through the rabbit-hole into a world where these techniques are applied to fix the democratic discourse! To this end, we will tinker quick and dirty solutions in small groups. Finally share our insights in plenum. Join the journey!
Dialog Session 2

Science busking as a gateway to conversation


Sara Petchey and Morana Mihaljevic, AGORA Coordinator, University of Zurich

 

Site

How do we «break the ice» in conversations between scientists and the public? Engaging the traditionally less scientifically oriented citizen depends a lot on initial impressions. In this presentation, we describe and model «science busking», a concrete and playful tool for catching the attention of a passerby and engaging him or her in a challenge or puzzle. This interaction can then lead to conversations about science or simply further acquaintance building with the scientist. We also give actual results of this outreach method from the project, «Biodiversity Means Life», a travelling biodiversity roadshow representing the research of a group of scientists from the University of Zurich. The target audience member for our session is a person who has an interest in, plans, and/or carries out public outreach projects. Participants can expect to learn about an innovative and tested technique for facilitating communication with the public.

Vers l’élaboration d’un guide d’accompagnement des pratiques de médiation scientifique?


Dr. Richard-Emmanuel Eastes, Réseau romand Science et Cité, Lausanne

 

Site

 

Une médiation scientifique de qualité nécessite l’adoption d’une démarche réflexive, qui commence par la confrontation de ses objectifs implicites aux désirs, attentes ou besoins des publics auxquels elle s’adresse. Cette réflexivité est parfois difficile pour ceux qui s’engagent dans une activité de médiation, car elle suppose d’accepter de remettre en question leurs approches spontanées et intuitives. Dans la perspective de la construction d’une médiation culturelle socialement pertinente, c’est à dire utile, équitable et responsable, le Réseau romand Science et Cité se propose d’élaborer collaborativement, avec la communauté de la culture scientifique issue des trois régions linguistiques suisses, un guide d’accompagnement des pratiques de médiation scientifique. Inspiré du guide de médiation musicale élaboré par l’association Médiation Culturelle Suisse, il en reprend les dimensions principales et interroge la médiation à travers les questions : Quoi ? Pourquoi ? Pour qui ? Comment ? Qui ? Cette activité permettra d’évoquer la pertinence de ce guide et de recueillir réactions et propositions en vue de son élaboration ultérieure.

PubliFarm : de la recherche sur le développement durable agricole à la consommation durable


Karin Güdel et Tibor Gyalog, Haute école pédagogique du nord-ouest de la Suisse,
Bâle

 

Site

Dans la Dialog Session, vous apprendrez comment le projet AGORA « PubliFarm » a pu montrer que l’alimentation a des répercussions non seulement sur notre santé, mais aussi sur la santé de notre planète. A l’aide d’un simple « jeu de la marchande », nous essayons d’attirer l’attention de manière ludique sur les relations complexes qui existent entre la consommation alimentaire, l’agriculture, la biodiversité et le changement climatique. En venant chez nous, les visiteurs peuvent collecter des points de biodiversité et de climat et composer un petit-déjeuner respectueux de la biodiversité et un repas du soir respectueux du climat. Des expérimentations simples, des jeux et des tâches épineuses leur permettent de comprendre les interdépendances et de gagner plus de points. Lors de ScienceComm ’17, vous aurez l’occasion de tester vous-même certains des jeux et expérimentations présentés en exemple.

Globi à l’EPF de Zurich


Isabelle Herold et Karin Köchle, EPF Zurich

 

Site

Le dernier volume de ce livre pour enfants très apprécié se passe à l’EPFZ. Il est paru en février 2017 sous le titre « Globi und die verrückte Maschine ». Comment l’EPFZ a-t-elle eu l’idée d’un tel projet ? Et qu’en attend-elle ? D’un côté, nous avons un établissement parmi les meilleurs au monde qui incarne le sérieux et l’exactitude et de l’autre, un héros pour enfant imaginaire, quasiment inconnu hors de Suisse (alémanique) et qui ne pense qu’à faire des sottises : n’est-ce pas contradictoire ? La brève présentation et la discussion qui suivront seront l’occasion de présenter la genèse de cette coopération, les obstacles qu’il a fallu surmonter lors de la réalisation et la signification de ce dialogue pour les deux partenaires très différents que sont l’EPFZ et Globi Verlag.
Workshops

Formation au débat « reatch don’t preach »


Joel Lüthi, reatch, Zurich

 

Site

 

Présentation

« Reatch, don’t preach » est une formation à la communication et à la discussion interactive sur des thèmes scientifiques et techniques. Trop souvent, les discussions se transforment en véritables batailles de faits ou d’opinions et les arguments des opposants ne sont pas pris en considération. Lors de cette formation, les participants apprennent de manière interactive comment bien discuter de thèmes scientifiques et comment défendre chaque position avec des arguments pertinents. Après une brève introduction, les participants débattront, à partir de positions qui leur auront été attribuées, de thèmes scientifiques, apprenant ainsi la dynamique d’un débat et comment pénétrer au coeur d’une problématique. Cette formation est organisée et coordonnée par l’association reatch – research and technology in Switzerland.

Developing creative skills with improvised comedy


Dr. Samuel Lagier, The Renegade Saints, Geneva

 

Site

 

Présentation

Everybody is creative, but a lot of individuals repress their creativity out of lack of confidence. Improvised comedy is the art of making things up on the spot and helps silence one’s inner critique. With the creation of a supporting environment and the joy of having fun, participants will (re)discover their creative self. Improv is the fundation of the Catalyst, an association based in Lausanne whose missions are to 1) make scientists better communicators 2) create new media to communicate science.

Gif Your Science : un workshop méthodologique sur les formats visuels courts dans la communication scientifique


Johanna Barnbeck, chercheuse en art et conseillère créative pour la science, Berlin et Rebecca Winkels, responsable de projet chez Wissenschaft im Dialog, Berlin

 

Site

 

Site

Ce workshop se concentrera sur les formats visuels courts dans la communication scientifique : avec « science gifs », il est facile d’attirer l’attention sur un thème de recherche. Les gifs sont partagés sur différentes plateformes de médias sociaux ou via Messenger. Leur portée et leur accessibilité sont ainsi plus directes que des vidéos sur le Web par exemple. Comment conçoit-on des gifs ? A quoi servent-ils dans la communication scientifique ? Quelles images et données sont à ma disposition pour mes travaux de communication ou de recherche ? Et comment puis-je accéder à des contenus de recherche plus approfondis avec des gifs ? Lors de notre workshop, nous concevrons ensemble des gifs à l’aide des matériaux visuels que vous aurez apportés. Pour ceux qui n’apporteront pas de matériel, quelques exemples de projets seront proposés afin que chacun(e) puisse apprendre et comprendre le processus pratique. Pour finir, nous discuterons des résultats et donnerons un feed-back sur les gifs créés.
Résumé

Site

 

Site

 

Video

De Philipp Burkard, Science et Cité, Berne et Béatrice Pellegrini, Réseau romand Science et Cité, Lausanne