Donnerstag, 21. September 2017
Begrüssung und Keynote Vortrag

#DieBombe – Die ganze Wahrheit über Cambridge Analytica

 

Hannes Grassegger, Journalist und Ökonom, Zürich 

Wie eine Reportage aus dem Schweizer «Das Magazin» in Rekordzeit Millionen von LeserInnen fand, zum meistgeteilten deutschsprachigen Text des Jahres 2016 wurde, anschliessend in zwanzig anderen Sprachen viral ging – und in jedem Land eine ganz andere Diskussion auslöste. Die Geschichte der Rezeption des vielleicht kontroversesten deutschsprachigen Textes der letzten Jahre ist ein Lehrstück über die Schwierigkeiten und Möglichkeiten des Journalismus in einer Zeit des rasanten technischen Fortschritts. Der federführende Magazin Autor Hannes Grassegger analysiert erstmals die Nachwirkungen des gemeinsam mit Mikael Krogerus verfassten Textes.

Workshops

Virtual & Augmented Reality im Bildungskontext: Chancen und Möglichkeiten

 

Raphael Wild und Max Hemmo, Lernetz, Bern

 

Website

 

 

Die technischen Möglichkeiten von Augmented Reality (AR) und Virtual Reality (VR) sind immens. Welche Methoden und Angebote im Bildungskontext einsetzbar sind, demonstriert dieser Workshop. Der Workshop gliedert sich in die drei Blöcke Hand’s on, Projektskizze und Machbarkeit.
1/ Es kann mit folgenden Geräten mit von uns produzierten Inhalten exploriert werden: Highend AR (Microsoft Hololens), Lowend AR auf dem Smartphone, Highend VR-Brille (HTC Vive) sowie Lowend VR (Google Cardboard). Dieses Spektrum ermöglicht eine breite Beurteilung der Vor- und Nachteile dieser neuen Technologien im Einsatz.
2/ Aufgrund der Inputs aus dem Hand’s on-Teil werden eigene VR- und AR-Projektskizzen und Einsatzszenarien entwickelt und im Anschluss präsentiert.
3/ Input zu Machbarkeit und Workflow von AR/VR-Projekten: Vorstellung von Methoden, wie man von der Idee zu einer fertigen 3D-Anwendung kommt.

Wortwerkstatt

 

Beatrice Lugger und Dr. Tobias Maier, Nationales Institut für Wissenschaftskommunikation, Karlsruhe

 

Website

 
Sprache ist durchaus auch Handwerk. Was genau damit gemeint ist? Dafür greifen wir tief in die Werkzeugkiste, um in einem spielerischen Wettstreit an einem selbst
zusammengesetzten Satz zu feilen. Schon einige wenige Kniffe helfen, damit ein Text nicht nur inhaltlich korrekt ist, sondern auf Anhieb verständlich wird. Eine anschauliche, prägnante Sprache ist aber unverzichtbar, um komplexe Zusammenhänge zu vermitteln. «Wissenschaft für alle» bedeutet eben auch, in der Wissenschaftskommunikation so zu formulieren, dass möglichst alle verstehen, worum es eigentlich geht. Die Teilnehmerinnen und Teilnehmer erleben in der «Wortwerkstatt» anschaulich, welche sprachlichen Mittel dabei besonders hilfreich sind. Dazu bilden wir Teams, die gegeneinander antreten, um mit sprachlichem Sportsgeist die überzeugendste Lösung zu finden. Schauen wir mal, wer am Ende die Nase vorn’ hat, wenn es darum geht, sperrige Formulierungen, verkorkste Beispiele und überflüssige Satzbestandteile zu bearbeiten. Geleitet wird die «Wortwerkstatt» von erfahrenen Dozenten des Nationalen Instituts für Wissenschaftskommunikation (NaWik).
Dialog Session 1

Next Trends from San Francisco


Rahel Meier, Sustainability Communications Group, ZHAW und NCCR Digital Fabrication und Tanja Coray, NCCR Digital Fabrication, Zurich

 

Website

 

Website

 

 

 

 

The San Francisco Bay Area is well-known for exploring innovation in storytelling and outreach – things like virtual and augmented reality, crowdfunding, events and festivals, the maker movement, and social media storytelling. How do these trends apply to the field of science communication in San Francisco and what lessons can Switzerland learn from this ecosystem? In June and July, Rahel Meier and Tanja Coray will explore the science communication landscape of San Francisco as the first two fellows of swissnex San Francisco’s new Pier 17 Science Studio program. During this session, Rahel and Tanja will report what they discovered through meetings with various museum experts, artists, and science communication professionals, and what they learned by carrying out their fellowship project. The discussion focuses on how these findings can be transferred to the Swiss science communication community.

Leonardo multimedial: Peer-basierte Wissenschaftskommunikation von Jugendlichen


Prof. Matthias Künzler und Prof. Thomas Weibel, Hochschule für Technik und Wirtschaft, Chur

 

Website

Die Wissenschaftskommunikation steht vor der Schwierigkeit, nicht-wissenschaftsaffine Jugendliche zu erreichen, die vor der Berufswahl stehen. In Anbetracht des Fachkräftemangels und der steigenden Anforderungen durch die Digitalisierung der Berufswelt ist dies von grosser gesellschaftlicher Relevanz. Ein interdisziplinäres Team von Multimediaproduzenten und Sozialwissenschaftlern plant deshalb einen neuen Weg:
Dieser stellt die Unbefangenheit der Jugendlichen im Umgang mit neuen Technologien in den Dienst der Wissenschaftskommunikation. Jugendliche sollen mit ihren eigenen Geräten (Handys, Tablets, Notebooks) nach dem Prinzip BYOD («bring your own device») multimediale Wissenschaftsreportagen produzieren und innerhalb ihrer Peer-Gruppe verbreiten. Dabei werden Sie von Fachleuten gecoacht. Das durch die Gebert-Rüf-Stiftung finanzierte Projekt soll den Teilnehmenden der Tagung auf praktische Weise näher gebracht werden: Nach einer kurzen Einführung erhalten diese die Gelegenheit, die auf heutigen Mobilgeräten vorhandenen technischen Möglichkeiten selbst zu testen. Als Hilfsmittel werden dafür ein Videoscreen, ein iPad, Schulungsflyers sowie die Geräte der Teilnehmenden eingesetzt.

DNA anders


Dr. Marie-Claude Blatter, Schweizerisches Institut für Bioinformatik (SIB), Genf

 

Website

Das Schweizerische Institut für Bioinformatik (SIB) hat einen modularen Workshop ausgearbeitet, der für die Öffentlichkeit zugänglich ist und folgende Ziele verfolgt: (1) auf spielerische und authentische Weise aufzeigen, was DNA im Digitalzeitalter bedeutet; (2) mithilfe von Bioinformatik-Tools besser verstehen, was «mein» Erbgut bedeutet; (3) eine Verbindung zwischen molekularen Daten und Evolution herstellen und (4) die Diskussion über soziale Themen wie personalisierte Medizin anstossen. Die im Rahmen des Workshops durchgeführten Aktivitäten basieren auf dem Buch, in dem die DNASequenz des menschlichen Chromosoms 21 abgedruckt ist (48 Millionen Nukleotide, 1470 Seiten). Ebenso kommt ein Genome Browser (freier Zugang über Internet) zur Anwendung. Mithilfe einiger einfacher Versuche soll die DNA (neu) entdeckt werden. Finden Sie beim Schimpansen eine DNA-Sequenz des menschlichen Chromosoms 21? Lässt sich die DNA-Sequenz «atgcaatcatatgcttctgct» einem Mann oder einer Frau zuordnen? Denken Sie, dass Sie eine zufällig ins menschliche Erbgut integrierte DNASequenz wiederfinden können?

Show Me Maths!


Dr. Shaula Fiorelli Vilmart, Mitverantwortliche Mathscope, Universität Genf

 

Website

Die Mathematik: eine Wissenschaft, bei der man nichts manipulieren kann, da ihre Objekte abstrakt sind? Das gilt nicht im Mathscope! Im Sciencscope-Labor der Universität Genf, das der Mathematik gewidmet ist, kann man verschiedene mathematische Konzepte – von der Geometrie über die Topologie, Wahrscheinlichkeitsrechnung und Statistik bis hin zur Logik – berühren, manipulieren, damit experimentieren, und dies manchmal mit dem ganzen Körper. Das Mathscope richtet sich an Gruppen von 5 bis 25 Personen im Alter von 4 bis 104 Jahren. Es bietet einstündige interaktive Workshops, bei denen das Motto «experimentieren» heisst. Aber das ist nicht alles. Das Team von Mathscope nimmt seit zwei Jahren an «Science Me!» teil, der Europameisterschaft der Wissenschaftsshows. Bei der ersten Ausgabe im Jahr 2016 hat es sogar den Jury-Preis gewonnen. Wie aber konzipiert man eine 10-minütige Show zu einem derart abstrakten Konzept wie der Dimension? Wie können mathematische Konzepte manipulierbar gemacht werden? Lässt sich ein interaktiver Workshop unabhängig vom behandelten mathematischen Thema so gestalten, dass er die Neugier der Teilnehmer weckt? Diese Fragen versuchen wir anhand einiger Beispiele und konkreter Situationen zu beantworten.

Ein Award, um das Wissen über Citizen Science in Österreich zu verbreiten


Petra Siegele, Österreichische Austauschdienst Bundesministerium für Wissenschaft, Forschung und Wirtschaft, Wien

 

Website

Um das Wissen über Citizen Science in Österreich zu verbreiten, unterstützt das Bundesministerium seit 2015 mit dem Citizen Science Award ausgewählte Citizen Science-Projekte dabei, engagierte Citizen Scientists für die Mitarbeit an Forschungsprojekten zu begeistern. Die Unterstützung erfolgt dabei sowohl durch die Ausrufung der mit 3000.– Euro dotierten Awards, als auch durch österreichweite Massnahmen der Öffentlichkeitsarbeit sowie regelmässige Reflexionsworkshops für die teilnehmenden Forschungsprojekte. Vergeben werden die Awards jeweils im Rahmen einer medienwirksamen Festveranstaltung in Wien. Für die Umsetzung dieser Initiative beauftragte das BMWFW das bei der OeAD-GmbH angesiedelte Zentrum für Citizen Science. Mag. Petra Siegele, Leiterin des Zentrums, geht in ihrem Input näher auf die Marketing- und Kommunikationsmassnahmen zur Bewerbung des Awards sowie die bisherigen Lessons Learned sowohl beim Marketing, als auch bei der Umsetzung der Gesamtinitiative, ein. Welche Zielgruppen konnten wie erfolgreich zur Teilnahme animiert werden? Vor welche Herausforderungen werden Forschungsprojekte durch die Ausrufung der Awards gestellt? Und wie kann das Zentrum hier Unterstützung bieten?
Workshop

Tinkering: Workshops, um die technische Kreativität zu fördern


Dr. Richard-Emmanuel Eastes, Groupe Traces, Paris

 

Website

 

Präsentation

 

Tinkering

Die Wissenschaftsvermittlung geht weit über die Vermittlung von Wissen hinaus. Sie kann etwa dazu beitragen, die Selbstzensur von jungen Männern und Frauen im Bereich der Wissenschaft und der Technologie zu bekämpfen. Unter den möglichen Ansätzen eignen sich die Workshops auf dem Gebiet der technischen Kreativität, die das Exploratorium in San Francisco entwickelt und das Espace des sciences Pierre-Gilles de Gennes in Paris von ihm übernommen hat, besonders gut, um die Neugierde zu wecken und gleichzeitig die Selbstbefähigung im technischen, unternehmerischen und sozialen Bereich sowie in Gleichstellungsfragen zu fördern. Ihr Zweck ist nicht so sehr, wissenschaftliche Konzepte zu lehren. Viel eher geht es darum, den Teilnehmern klarzumachen, dass sie trotz eines schwachen Selbstvertrauens über die notwendigen Ressourcen verfügen, um scheinbar komplexe Herausforderungen zu meistern. In diesem Workshop präsentieren wir das Konzept des «Tinkering», indem wir es zuerst anhand einiger Beispiele veranschaulichen und anschliessend experimentell umsetzen. Wie baut man eine Maschine, die fliegt? Eine Maschine, die zeichnet? Eine Maschine, die «irgendetwas» erstellt, sich jedoch nach einer Betriebszeit von 5 Minuten selber zerstört? Am Ende des Workshops folgt eine Diskussion zu den Herausforderungen, Vorzügen und Grenzen dieses originellen Ansatzes.
Speed Talk Session 1

The Crowdfunding Freak Show


Luc Henry, Science Booster at wemakeit.com, Zurich

 

Website

 

Präsentation

The popularity of Crowdfunding is on the rise – also in science. With our «Crowdfunding Freak Show», we discuss a selection of projects that successfully collected funding through our Science Booster, the first crowdfunding channel in Switzerland entirely dedicated to science.

Show Me Science! Gleichstellung als filmische Momentaufnahme: Erfahrungen mit einem AGORA-Projekt


Lucie Bader, outreach gmbh – Film und Wissenschaftskommunikation, Bern

 

Website

 

Präsentation

Sind Sie fit beim Thema Geschlechtergleichstellung? Lohngleichheit? Teilzeitarbeit? Schauen Sie sich den Film «Gleichstellen – eine Momentaufnahme» an, lassen Sie sich durch die E-Learning Box mit Hintergrundwissen stimulieren oder nutzen Sie die Workshop-Anleitungen für Ihre betriebliche Weiterbildung! Alle diese Kommunikationsmittel bietet das AGORA-Projekt «gleichstellen.ch». Sie wurden im Rahmen des Projekts für den Dialog in der Öffentlichkeit entwickelt und basieren auf sozial-wissenschaftlichen Erkenntnissen. Ziel des Projekts war es, Mechanismen aufzuzeigen, wie geschlechtsspezifische Ungleichheiten reproduziert werden, und Massnahmen zur Verbesserung der Gleichstellung vorzuschlagen. Der Dokumentarfilm, Materialien für Workshops und eine E-Learning Box stehen auf der Webseite «www.gleichstellen.ch» kostenlos zur Verfügung. Sie sind mit der Unterstützung von AGORA an der HSLU realisiert worden. Wir berichten von den Herausforderungen, denen sich das Projektteam von der Idee bis zum ersten Auftritt stellen musste, und den dabei gemachten Erfahrungen aus der Sicht der Wissenschaftskommunikation.

Genetik in den Schweizer Printmedien


Bettina Zimmermann, Institut für Bio- und Medizinethik, Universität Basel

 

Website

 

Präsentation

Ob Präimplantationsdiagnostik, CRISPR oder Gentests aus dem Internet: zum Thema Genetik öffnet sich ein ganzes Spannungsfeld von öffentlichkeitsrelevanten Themen. Inwieweit werden diese in den Medien beleuchtet? Im Rahmen meiner Dissertation an der Uni Basel untersuche ich, welche Themen rund um das Thema Humangenetik von den Printmedien in der deutsch- und französischsprachigen Schweiz in den letzten vier Jahren wie häufig beleuchtet wurden. Die Ergebnisse spiegeln zu einem gewissen Grad den öffentlichen wissenschaftlichen Diskurs in der Schweiz wieder, der unter anderem stark geprägt war von den Abstimmungen zur Präimplantationsdiagnostik. Im Speed Talk möchte ich einige Ergebnisse meiner Studien vorstellen, und die möglichen Implikationen betreffend Wissenschaftsjournalismus anregen und diskutieren.

Newsroom in der Hochschulkommunikation: Top oder Flop?


Jürg Dinner, Leiter Kommunikation, Universität Zürich

 

Website

 

Präsentation

 

Digitalisierung macht auch vor der Hochschulkommunikation nicht halt. Neue Medien, crossmediales Arbeiten, digital first sind nur ein paar Stichworte. Kann hier der vielzitierte Newsroom ein Ansatz sein? Was ist ein Newsroom? Können Themen und Kanäle wirklich getrennt werden? Die Kommunikation der grössten Schweizer Hochschule hat sich neu erfunden. Wie? Und welche Erfahrungen hat sie dabei gemacht? Was lässt sich für meine Hochschule oder meine Redaktion daraus lernen?

Experimente im Dienst der Lernstrategien


Dr. Mona Spiridon, Bioscope und Geneva Neurocenter, Universität Genf 

 

Website

 

Präsentation

Um die Menschen von der Angemessenheit einer Methode zu überzeugen, genügt das Präsentieren von wissenschaftlichen Erkenntnissen manchmal nicht. Die Aktivität «Mémoire et apprentissage» (Gedächtnis und Lernen), die von Bioscope, dem öffentlichen Labor der Universität Genf, in Zusammenarbeit mit dem Geneva University Neurocenter entwickelt wurde, setzt sich mit Lernstrategien auseinander. Um sich von der Wirksamkeit dieser Strategien zu überzeugen, probieren die Schüler diese aus und messen ihre eigenen Ergebnisse. Wissenschaftliche Studien zu diesem Thema werden mit den Schülern nachgestellt. Für jede Art von Lernen wird die Klasse in zwei Gruppen aufgeteilt; jede Gruppe wendet eine unterschiedliche Lernstrategie an. Dank einer Tablet-Schnittstelle haben die Schüler sofort Zugriff auf die Ergebnisse der Tests. Die Schüler können auf diese Weise feststellen, welche Gruppe die besseren Ergebnisse erzielt und welche Strategie entsprechend besser funktioniert hat. Ebenfalls angezeigt werden die kumulativen Ergebnisse aller Klassen, die an der Aktivität teilgenommen haben. Dieser Ansatz geht demnach über die einfache Erklärung von wissenschaftlichen Fakten hinaus. Er ermöglicht, die Empfehlungen zur Arbeitsorganisation mithilfe wissenschaftlicher Erkenntnisse, welche die Schüler durch ihre Experimente selber erlangt haben, zu untermauern.
Freitag, 22. September 2017
Begrüssung und Keynote Vortrag

Communicating scientific facts and the scientific process. Challenges and rewards.


Ana Godinho, Head of Education Communication and Outreach, CERN, Geneva

 

Website

 

Präsentation

It s a safe bet that everyone who works at CERN will, at some point, have been asked one, or both, of these questions: Will the LHC create a black hole that will destroy the Earth? What will CERN’s next big discovery be? These questions illustrate two of the major challenges that communicating the research carried out at CERN entails. One is how to communicate scientific knowledge when faced with myths and pseudo-scientific constructions, many of which have strong news value (for the media) and emotional appeal (for the public). The other is maintaining interest in CERN’s activities and in fundamental research in the face of a potential scarcity of «big breakthroughs» at the scale of the discovery of the Higgs boson in 2012.
This talk will describe how we tackle these big questions at CERN. Using examples, I will describe how CERN has proactively and successfully addressed the many myths around the LHC, antimatter and more. I will also describe how we are trying to fully explore our communication channels to find and tell stories about the diversity of scientific experiments at CERN, about CERN’s impact on society and about how scientific breakthroughs are often the cumulative results of small advances. This will be a talk about challenges and obstacles, but also opportunities and rewards, for CERN, for particle physics and for science communication.
Workshops

Wissenschaft visuell erzählen!


Chris Spatschek und Daniela Leitner, Nationales Institut für Wissenschaftskommunikation,
Karlsruhe

 

Website

Das, was wir von unserer Welt verstehen, wird immer komplexer und dies ist für Fachfremde und Laien oft nur schwer erklär- und vorstellbar. Reiner Text hat es hier nicht leicht, zumal die Art, wie wir miteinander kommunizieren, immer stärker durch Bilder und Visualisierungen geprägt wird. Der Mensch ist ein »Augentier« – Bilder bleiben viel stärker im Gedächtnis haften als reiner Text. Mit ihnen lassen sich Informationen leichter zugänglich und begreiflich machen. Genau dies wollen wir uns zunutze machen. Wir tauchen ein in die Welt der Kreativität und werden sie mit der Welt der Wissenschaft verbinden. Unsere Neugierde werden wir dabei als wichtigstes Instrument nutzen, um Dinge aus anderen Blickwinkeln zu betrachten und Bisheriges zu hinterfragen. Dabei werden wir schliesslich Ideen zu Papier bringen, die Inhalte auf unkonventionell andere Art vermitteln, Interesse wecken und ihre Zielgruppe treffsicher erreichen. Übrigens: Wer kreativ sein will, muss nicht unbedingt zeichnen können oder sich mit komplizierten Visualisierungs-Programmen auseinandersetzen! Der Workshop richtet sich an alle, die offen für Neues sind und Lust an der Erkenntnis haben.

Wissenschaftskommunikation mit Wirkung


Dr. Urs Müller, Institut für Umwelt und Natürliche Ressourcen, ZHAW, Wädenswil und Sandra Wilhelm, anders kompetent GmbH, Winterthur

 

Website

 

Website

 

Präsentation

Akteure der Wissenschaftskommunikation sehen sich vermehrt mit der Frage konfrontiert, was ihre Arbeit bringt. So verlangen beispielsweise Geldgeber, meist Stiftungen oder die öffentliche Hand, immer häufiger Nachweise zur Wirkung ihrer Investitionen. Doch was heisst Wirkung? Wie kann die Wirkung gesteigert werden? Und wie können wir uns sicher sein, die angestrebte Wirkung zu erzielen? Im Workshop werden diese Fragen direkt an eigenen Arbeitsbeispielen der Teilnehmenden bearbeitet. Dazu wird ein vom Forschungsbereich Nachhaltigkeitskommunikation der ZHAW und der anders kompetent GmbH mit Unterstützung der Stiftung Mercator Schweiz, des Bundesamts für Umwelt und des WWF weiterentwickeltes Instrument vorgestellt und angewendet. Das Instrument behandelt die drei wesentlichen Schritte der Wirkungsorientierung von Bildungs- und Kommunikations-angeboten: Formulierung der Ziele und der Wirkungslogik, Optimierung der Methoden und Instrumente und Evaluation der Zielerreichung. Ziel des Workshops ist es, dass die Teilnehmenden die Vorteile des wirkungslogischen Denkens erkennen und das präsentierte Instrument selbständig auf ihre eigene Arbeit anwenden können.

Exkursion ins Naturmuseum Solothurn

Hinter den Kulissen einer Ausstellung


Dr. Thomas Briner, Museumsleiter

 

Website

Ausstellungen gehören zu den wichtigsten Vermittlungsmöglichkeiten von Museen. Sie müssen dabei ein breites Publikum erreichen – von jung bis alt, vom Laien bis zum Experten. Dazu muss eine Ausstellung Informieren wie auch Unterhalten und dabei möglichst alle Sinne ansprechen. Wie gelingt dieser Spagat? Welche Wekzeuge stehen uns bei der Vermittlungsform Ausstellung zur Verfügung? Am Beispiel der sich gerade im Aufbau befindenden neuen Dauerausstellung werden konkrete Beispiele vorgestellt.

Museumspädagogik: Von Schulklassen bis zu Integrationsarbeit


Joya Müller, Museumspädagogin

 

Website

Gruppenbesuche im Museum bieten die Gelegenheit, Inhalte vertieft und am Objekt zu behandeln. Rund 300 Gruppen pro Jahr besuchen das Museum und profitieren von den bereitgestellten Hilfsmitteln. Schulklassen, welche mit oder ohne Begleitung der Museumspädagogin an Aufträgen aus dem Museumskoffer arbeiten nutzen das museumspädagogischen Angebot. Und auch für die Integrationsförderung bietet das Museum Möglichkeiten.
Die Museumspädagogin stellt an praktischen Beispielen mögliche Hilfsmittel für ihre Vermittlungsarbeit vor.

Erdgeschichte: Interessen für Steine wecken

 

Silvan Thüring,
Sammlungsverantwortlicher Erdwissenschaften / Multimedia

 

Website

Erdgeschichtliche Inhalte sind nicht leicht zu vermitteln. Den Steinen fehlen nicht nur «knuffige» Augen, sondern sicherlich auch das flauschige Fell! Aber das sind nicht die einzigen Steine, die dieses Thema dem Laien in den Weg legt. Immense Zeiträume von Millionen von Jahren und vergangene Welten faszinieren gleichsam, wie sie verwirren können. Das Naturmuseum Solothurn will mit seinen Ausstellungen Interesse auch für komplexere Themen wecken und die Neugier für naturwissenschaftliche Sachverhalte stärken.
Speed Talk Session 2

«Science Me!» science show competition: the right format?


Dr. Didier Perret, Chimiscope, University of Geneva

 

Website

 

Präsentation

«Science Me!» is an innovative science communication tool, with the format of a competition organised during a science fair and bridging scientists and laymen: during 10 minutes, teams of 2 scientists make a show which is evaluated by the public (audience-weighted applause-meter signal) and by a jury of experts in science communication (quantitative multi-criteria ranking). The best teams are the winners, but what does «best team» mean? For the first occurrence of «Science Me!» (Geneva, 2016), a detailed analysis of the scores attributed by the audience and the jury indicates that the public is a smart evaluator reacting almost exclusively on the emotional aspects of a scientific demonstration (is it understandable, fun and spectacular?), while the experts focus on the rational aspects of the show (Is it based on sound background? Does it comply with safety rules?). This discrepancy calls into question the relevance of science communication initiatives meant at bringing scientific facts to the laymen in an affordable way.

It’s the genetics, stupid! Zum Umgang mit genetischen Infos heute und morgen


Bettina Zimmermann, reatch, Zürich

 

Website

 

Präsentation

Dank technischer Entwicklungen hat die Wissenschaft enorme Fortschritte im Bereich Genetik gemacht. Daher werden wir alle in Zukunft vermehrt mit genetischen Tests konfrontiert werden: in der Apotheke, als Schwangere beim Frauenarzt, beim Routinecheck, durch positiv getestete Verwandte usw. Da das Thema und dahinter liegenden Entscheidungen komplex sind, ist es wichtig, dass man sich bereits heute mit den grundlegenden Fragen auseinandersetzt: Möchte ich einen spezifischen genetischen Test oder nicht? Welche Resultate möchte ich wissen – und welche nicht? Erzähle ich meinen Verwandten von dem Gentestresultat? Lasse ich meine (ungeborenen) Kinder testen? Inwiefern möchte ich biologische Merkmale meinen Lebensstil bestimmen lassen? Der junge think tank reatch plant, mit einer online Plattform fachfremden Personen diese Fragen bewusst zu machen und faktenbasierte, leicht verständliche Informationen zur Verfügung zu stellen. Diese sollen BesucherInnen bei der Entscheidungsfindung zur Beantwortung der Fragen unterstützen. Wir legen dabei grossen Wert auf Quellentransparenz und ausgeglichenen Debatten. Die Plattform wird interaktiv gestaltet, mit Kommentarfunktionen unter allen Inhalten sowie einer Frage-Antwort-Sparte.

Virale Hepatitis: Mehr Aufmerksamkeit für eine stumme Infektion


Fabienne Schöpfer, Life Science Communication, Zürich

 

Website

 

Präsentation

100 000 Betroffene – die Hälfte weiss es nicht: die Dunkelziffer der Hepatitis-Infektionen in der Schweiz ist alarmierend. Ziel der Schweizerischen Hepatitis-Strategie ist es, die Anzahl der Hepatitis-Diagnosen zu erhöhen. Doch wie lässt sich die Aufmerksamkeit einer breiten Zielgruppe für eine Krankheit wecken, deren Folgen erst Jahre später auftreten? Wie fordert man zu einem Test auf, der die Zielgruppe womöglich mit einem unangenehmen Resultat konfrontiert? «Hepatitis: Kennst Du das ABC?» lautete das Motto der ersten Phase einer dreijährigen Kampagne und vermittelte Basiswissen zur Krankheit. Die nächste Phase legte den Fokus auf aktuelle und vergangene Risikosituationen für eine Hepatitis-Infektion. Mit einem Test konnte die Zielgruppe online ihr Risiko abfragen. Die dritte Kampagnenphase geht on Tour und holt mit einer Gratis-Testwoche die Zielgruppe direkt in ihrem Alltag ab. Der Vortrag zeigt, wie mit einer mehrjährigen Kampagne eine breite Zielgruppe für ein komplexes, schubladisiertes Thema sensibilisiert werden kann und wie interaktive Tools, Videos und Social Media Aktivitäten einer abstrakten Risikosituation zu individueller Relevanz verhelfen.

Engaging in a useful dialogue with the public: The Climate Garden 2085 experiment


Dr. Manuela Dahinden, Zurich–Basel Plant Science Center, Zurich

 

Website

Climate change has been communicated as a global concern affecting us all, but there is still a disconnection between scientific information and political and social action – the climate paradox. This has been a cause for concern among scientists for some time now. But if, as psychologists tell us, the human brain responds better to experience than to analysis, then climate change must be told as a local and personal story – just as the Climate Garden 2085 does.
Keynote Vortrag

Wissenschaftskommunikation auf YouTube – ein Praxisbericht


Paul Hoyningen, Leibniz Universität Hannover und Universität Zürich

 

Website

 

Website

 

Präsentation

Im Vortrag berichte ich über meinen YouTube Kanal «PHoyningen», den ich seit gut vier Jahren betreibe. Im Moment sind dort ca. 220 Videos hochgeladen, die zurzeit ca. 200 000 Aufrufe pro Jahr erhalten. Darunter befinden sich mehrere Vorlesungen, die über ein ganzes Semester gehalten wurden, sowie Vorträge, Interviews, Fernsehmitschnitte und Ähnliches. Viele Themen stammen aus der Wissenschaftsphilosophie, was die populäre Darstellung naturwissenschaftlicher Inhalte einschliesst. Zunächst werde ich einige Fakten des Kanals darstellen und die Überlegungen, die mich dabei geleitet haben. Dann werde ich auf einige der didaktischen Prinzipien eingehen, die ich bei meiner Lehr- und Vortragstätigkeit zur berücksichtigen versuche. Schliesslich berichte ich kurz über das erstaunliche Feedback, das ich immer wieder erhalte.
Workshops

Wissenschaftsferien für Jugendliche


Jenny Flück, Science et Cité, Bern und Juanita Schläpfer-Miller, Zurich-Basel Plant Science Center, Zürich 

 

Website

 

Website

Seit nun 3 Jahren wird in der Deutschschweiz das Projekt Camp Discovery durchgeführt. Dieses hat den speziellen Fokus, Kinder und Jugendliche aus so genannt bildungsfernen Schichten zu erreichen und ihnen die Welt der Wissenschaft näher zu bringen. An der diesjährigen Science Comm möchten wir alle, die an ähnlichen Themen arbeiten, zusammenbringen und besonders der Frage nachgehen, wie Wissenschaft in einem Ferienlager spannend vermittelt werden kann. Nach einer kurzen Einführung in das Projekt von Science et Cité und dem Plant Science Center Zurich-Basel wird in Gruppen an gezielten Fragestellungen gearbeitet, die zum Schluss dem Plenum präsentiert werden. Dabei werden die verschiedenen Ferienlageranbieter und Kinderprogrammentwickler miteinander vernetzt und mögliche Synergien diskutiert.

What if we applied insights from neuroscience to the democratic discourse?


Jannes Jegminat, Institute for neuroinformatics (UZH/ETH), Zurich and Valeria Eckhardt, Institute of neuropathology (University hospital Zurich)

 

Website

 

Website

 

Präsentation

Filter bubbles, shit-storms and ever more polarised opinions: Is the democratic discourse broken? We can no longer blame the individual citizen for a lack of media competence or education – because technology is changing the very nature of how public debate works. Instead, it might be time to consider and actively design the architecture and dynamics of opinion networks. As inspiration for potential solutions, we will turn to neuroscience. Just like opinion networks, the brain is a network of many individual information processing units, the neurons; and both networks share analogous problems.
After a short input on neuronal information processing, we travel through the rabbit-hole into a world where these techniques are applied to fix the democratic discourse! To this end, we will tinker quick and dirty solutions in small groups. Finally share our insights in plenum. Join the journey!
Dialog Session 2

Science busking as a gateway to conversation


Sara Petchey and Morana Mihaljevic, AGORA Coordinator, University of Zurich

 

Website

How do we «break the ice» in conversations between scientists and the public? Engaging the traditionally less scientifically oriented citizen depends a lot on initial impressions. In this presentation, we describe and model «science busking», a concrete and playful tool for catching the attention of a passerby and engaging him or her in a challenge or puzzle. This interaction can then lead to conversations about science or simply further acquaintance building with the scientist. We also give actual results of this outreach method from the project, «Biodiversity Means Life», a travelling biodiversity roadshow representing the research of a group of scientists from the University of Zurich. The target audience member for our session is a person who has an interest in, plans, and/or carries out public outreach projects. Participants can expect to learn about an innovative and tested technique for facilitating communication with the public.

Praktiken der Wissenschaftsvermittlung: auf dem Weg zu einem Leitfaden?


Dr. Richard-Emmanuel Eastes, Réseau romand Science et Cité, Lausanne

 

Website

 

Für eine erstklassige Wissenschaftsvermittlung ist ein reflektiertes Vorgehen notwendig. In einem ersten Schritt müssen die eigenen impliziten Ziele den Wünschen, Erwartungen und Bedürfnissen des Zielpublikums gegenübergestellt werden. Diese Reflexivität ist manchmal schwierig für Menschen, die sich im Bereich der Vermittlung engagieren. Denn sie setzt voraus, dass man die eigenen spontanen und intuitiven Ansätze Infrage stellt. Wissenschaftsvermittlung soll etwas gesellschaftlich Sinnvolles sein, das heisst nützlich, gerecht und verantwortungsvoll. Vor diesem Hintergrund beabsichtigt das Réseau romand Science et Cité, gemeinsam mit den Vertretern der Wissenschaftskultur aus allen drei Sprachregionen der Schweiz einen Leitfaden auszuarbeiten, der die Praktiken der Wissenschaftsvermittlung beschreibt. Die Verfasser lassen sich dabei vom «Kompass Musikvermittlung» des Vereins Kulturvermittlung Schweiz inspirieren, dessen wichtigste Aspekte sie übernehmen. Der Leitfaden beleuchtet das Thema Vermittlung anhand folgender Fragen: Was? Warum? Für wen? Wie? Wer? Diese Dialog Session ermöglicht es, die Relevanz dieses Leitfadens zu erörtern. Gleichzeitig können Rückmeldungen eingeholt und Vorschläge gesammelt werden, die für die weitere Ausarbeitung nützlich sind.

PubliFarm: Von landwirtschaftlicher Nachhaltigkeitsforschung zum nachhaltigen Konsum


Karin Güdel und Tibor Gyalog, Pädagogische Hochschule FHNW, Basel

 

Website

In der Dialog-Session erfahren Sie, wie wir im Rahmen des AGORA-Projektes «PubliFarm » aufzeigen, dass das Essen nicht nur Auswirkungen auf unsere eigene Gesundheit hat, sondern ebenso auf die Gesundheit unseres Planeten. Anhand eines einfachen «Einkaufsspiels » versuchen wir, spielerisch auf die komplexen Zusammenhänge zwischen Nahrungsmittelkonsum, Landwirtschaft, Biodiversität und Klimawandel aufmerksam zu machen. Die Besuchenden können bei uns Biodiversitäts- und Klima-Punkte sammeln und sich ein biodiversitätsfreundliches Zmorge und klimafreundliches Znacht zusammenstellen. Einfache Experimente, knifflige Aufgaben und Spiele helfen ihnen die Zusammenhänge zu verstehen und mehr Punkte zu erzielen. An der ScienceComm ’17 haben Sie Gelegenheit, exemplarisch ein paar Spiele und Experimente selber zu testen.

Globi an der ETH


Isabelle Herold und Karin Köchle, ETH Zürich

 

Website

Der neuste Band des beliebten Schweizer Kinderbuchs spielt an der ETH Zürich. Er erschien im Februar 2017 unter dem Titel «Globi und die verrückte Maschine». Wie kommt die ETH dazu, ein solches Projekt zu lancieren? Und was verspricht sie sich davon? Auf der einen Seite eine Institution, die Seriosität und Faktentreue verkörpert und in der Internationalen Top-Liga mitspielt, auf der anderen Seite ein fiktiver Kinderheld, der ausserhalb der (Deutsch-)Schweiz kaum bekannt ist, und dessen blauer Papageienkopf voller Flausen steckt: Wie passt das zusammen? In der kurzen Präsentation und der anschliessenden Diskussion wird aufgezeigt, wie es zu dieser Kooperation kam, welche Hürden es im Zuge der Realisierung zu überwinden galt und was es für die zwei sehr unterschiedlichen Partner ETH und Globi-Verlag bedeutete, sich aufeinander einzulassen.
Workshops

Debattier Training reatch don’t preach


Joel Lüthi, reatch, Zürich

 

Website

 

Präsentation

«reatch, don’t preach» ist ein interaktives Kommunikations- und Diskussionstraining zu wissenschaftlich-technischen Themen. Allzu oft werden solche Diskussionen reine Fakten- oder Meinungs-Schlachten und auf die Argumente der Gegner wird nicht eingegangen. In diesem Training lernen die Teilnehmenden interaktiv, wie man wissenschaftliche Themen gut diskutiert und wie man jede Position mit stringenten Argumenten vertritt. Nach einer kurzen Einleitung debattieren die Teilnehmenden selbst mit zufällig zugeteilten Positionen zu wissenschaftlichen Themen, lernen so die Dynamik einer Debatte und wie man zum Kern einer Fragestellung vordringt. Dieses Training wird organisiert und koordiniert vom Verein reatch – research and technology in Switzerland.

Developing creative skills with improvised comedy


Dr. Samuel Lagier, The Renegade Saints, Geneva

 

Website

 

Präsentation

Everybody is creative, but a lot of individuals repress their creativity out of lack of confidence. Improvised comedy is the art of making things up on the spot and helps silence one’s inner critique. With the creation of a supporting environment and the joy of having fun, participants will (re)discover their creative self. Improv is the fundation of the Catalyst, an association based in Lausanne whose missions are to 1) make scientists better communicators 2) create new media to communicate science.

Gif Your Science: Ein Methodenworkshop zu visuellen Kurzformaten in der Wissenschaftskommunikation


Johanna Barnbeck, Künstlerische Forscherin und Kreativberaterin für die Wissenschaft, Berlin und
Rebecca Winkels, Projektleiterin bei Wissenschaft im Dialog, Berlin

 

Website

 

Website

In diesem Workshop dreht sich alles um visuelle Kurzformate in der Wissenschaftskommunikation: Mit «science gifs» lässt sich schnell Aufmerksamkeit für ein Forschungsthema gewinnen. Gifs lassen sich auf verschiedenen Social Media-Plattformen oder über Messenger teilen und haben so eine direktere Reichweite und Zugänglichkeit als z. B. Web-Videos. Aber wie erstellt man gifs? Wofür kann man sie in der Wissenschaftskommunikation einsetzen? Welche Bilder und Daten stehen mir in meiner Kommunikations- oder Forschungsarbeit zur Verfügung? Und wie knüpfe ich mit Gifs an tiefergehende Forschungsinhalte an? In unserem Workshop erstellen wir gemeinsam Gifs anhand der von Ihnen mitgebrachten visuellen Materialien. Für alle, die selbst kein Material mitbringen, gibt es einige Beispielprojekte, damit jede/r den praktischen Prozess lernen und nachvollziehen kann. Abschliessend besprechen wir die Ergebnisse und geben Feedback zu den entstandenen Gifs.
Résumé

Website

 

Website

 

Video

Von Philipp Burkard, Science et Cité, Bern und Béatrice Pellegrini, Réseau romand Science et Cité, Lausanne